Unicode escape' codec can't decode bytes in position 2-3: truncated \ uxxxxxxxx escape

Question

In this article, we will solve a syntax based problem of "Unicodeescape' codec can't decode bytes in position 2-3: truncated \uxxxxxxxx escape". This problem is encountered when we make a mistake in using the "unicode esacpe characters."Python's interpreter is designed to understand certain characters with certain symbols and in programming each character is given a unicode. This error occurs when the interpreter fails to distinguish between a normal character and a unicode character. We can solve this problem by simply manipulating the string according to the interpreter's logic. We will also discuss how these unicode character works and the reason behind this syntax problem. Let's quickly go through the contents of this article.

Table of contents: - 

1. Understanding the error and discussing how the interpreter functions.
2. Solving the error with a relevant example
   1. Solution 1.
   2. Solution 2.
   3. Solution 3.
3. Why unicode characters were assigned and steps to avoid this error.
4. The Conclusion

Understanding the error and discussing how the interpreter functions. #

Let's break this error statment down: "Unicodeescape' codec can't decode bytes in position 2-3: truncated \uxxxxxxxx escape". This means that there is a syntax error and the interpreter is not able understand the meaning of this code. The "Unicodeescape" term means that the syntax error is caused because the unicode escape characters are not used properly. Now we have a lot to dissect, let's start with the interpreter's logic. if we pass a command like: -

print('This is her mother's dress')

The output of this code will be: -

print('This is her mother's dress.')
          ^^^^^^^^^^^^^^^^^^^^^
SyntaxError: invalid syntax. Perhaps you forgot a comma?

Here, the interpreter is unable to understand the range of the string. We use " ' " character to set the range of characters to be printed. The interpreter is confused because it is not able to distinguish between a normal character and a single quote range setter. We can solve this problem with the help of escape sequences.

print('This is her mother\'s dress')

This is her mother's dress

Here , the backslash character instructs the interpreter that it is an escape sequence for the single quote character ('). As we observed that the interpreter was confused and this confusion led to a syntax error. This is the exact problem we are facing. Let's understand this with the help of an example.

Solving the error with a relevant example#

We know that the interpreter follow certain rules while printing and traversing the data. Suppose we have to load a file and traverse the data stored in it. We use the file handling concepts and perform the operation but on running the program we encounter the same error: -

path = "C:\Users\Dell\Downloads\lamdaphagevirus\lamda.txt"
file = open(path, "r")
data=file.read()
print(data)

path = "C:\Users\Dell\Downloads\lamdaphagevirus\lamda.txt"
                                                              ^
SyntaxError: (unicode error) 'unicodeescape' codec can't decode bytes in position 2-3: truncated \UXXXXXXXX escape

What went wrong here? The error is in the path variable. we passed the location of the file and it consists of multiple backslashes. Now the interpreter is confused which character is a normal character and which one is a unicode escape character. We know that the entire file location is a normal string without any unicode characters but the use of "\" characters is causing the problem. How are we going to solve this problem? Let's look at some solutions: -

Tip Each character is assigned with a unicode and an escape sequence which is universal for all the languages.

Solution 1

For the 1st solution, we will convert out string into a raw string like this: -

path = r"C:\Users\Dell\Downloads\lamdaphagevirus\lamda.txt"
file = open(path, "r")
data=file.read()
print(data)

GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCG
TCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGGC

A raw string is used whenever we want to avoid the technique of escaping characters with the help of backslashes. In order to convert a string into a raw string we have to simply add a "r" before the starting of the string. If this solution does not work for you then try the next method.

After this manually install "dlib" from this link. This can help the programmer to solve this issue.

Solution 2

If the the raw string method fails then try to escape the characters with the help of a backslash.

path = "C:\\Users\\Dell\\Downloads\\lamdaphagevirus\\lamda.txt"
file = open(path, "r")
data=file.read()
print(data)

GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCG
TCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGGC

For the interpreter a single backslash character means this "\\". All the escape characters begin with a backslash and by using this character before every backslash in the string, we can instruct the interpreter to treat this character as a escape sequence.

Solution 3

For the third solution we have to manipulate the string and replace every backslash with a "/" character.

path = "C:/Users/Dell/Downloads/lamdaphagevirus/lamda.txt"
file = open(path, "r")
data=file.read()
print(data)

GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCG
TCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGGC

Note In case of file handling, majority of the errors are caused due to an invalid location entry.

To know more about unicode errors vist this link.

Why unicode characters were assigned and how to avoid this error.#

Now that we have discussed the different solutions for the unicode error, we will try to understand the logic behind the designation of such codes. The main reason for assigning a universal code to every character was to establish uniformity in programming. During the early phases when technology was developing, majority of the codes were built around English language but as the technology progressed many nations started to get involved in this field. So, in order to avoid confusion and establish uniformity among the programming world, codes were assigned which were universal for all the languages around the globe.

We have to learn more about escape sequences and unicode if we want to avoid this kind of syntax error.

The conclusion

This article offers the most effective solution for the error: - "Unicodeescape' codec can't decode bytes in position 2-3: truncated \uxxxxxxxx escape". We discussed about the logic of interpreter and the different ways to solve this error. We strolled through the concepts of unicode and escape sequences. We also discussed the idea and purpose behind the creation of unicode.